| 產品名稱 |
Schizochytrium sp. |
| 商品貨號 |
B170193 |
| Classification |
KINGDOM: Chromista |
| Strain Designations |
S8 |
| Application |
Biofuel production |
| Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format |
frozen |
| Storage Conditions |
Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain |
no |
| Disclosure |
This material is cited in a US or other Patent and may not be used to
infringe the claims. Depending on the wishes of the Depositor, ATCC may be
required to inform the Patent Depositor of the party to which the material was
furnished. This material may not have been produced or characterized by ATCC. |
| Preceptrol® |
no |
| Morphology |
After 4-5 days at 20°C on By+ medium colonies are smooth and pale pink in color. Thallus epibiotic and interbiotic, thin-walled, globose; tetrad-shaped, becoming an amorphous mass. |
| Medium |
ATCC® Medium 790: By+ medium
ATCC® Medium 534: Seawater with serum
ATCC® Medium 662: Seawater medium
|
| Growth Conditions |
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence
CCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGGGTTCAACGGGTCTTTTCGCTGCTCGCAGCGAGTTGCTTTGCCGGAAGGCATGGCTAATCCTTTCAACGCTCATCGTGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGGTCCGATGAAACCATGGGATGACCTTTTGAGCGTTTATTCGCGATGGAGGTCAGAACTCGGGTGAATCTTATTGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTT
|
| Name of Depositor |
OmegaTech, Inc. |
| U.S. Patent Number |
|
| Isolation |
seawater, California |
| Cross References |
Nucleotide (GenBank) :
KC146351
18S rRNA gene
|
| References |
Barclay WR. Process for the heterotrophic production of microbial products with high concentrations of omega-3 highly unsaturated fatty acids. US Patent 5,130,242 dated Jul 14 1992
Jakobsen AN, et al. Endogenously synthesized (-)-proto-quercitol and glycine betaine are principal compatible solutes of Schizochytrium sp. strain S8 (ATCC 20889) and three new isolates of phylogenetically related thraustochytrids. Appl. Environ. Microbiol. 73: 5848-5856, 2007. PubMed: 17660311
|