| 產品名稱 |
HHCPB41 |
| 商品貨號 |
B178388 |
| Designations |
HHCPB41 |
| GenBank Number |
M78063
|
| Species |
Homo sapiens, human |
| Depositors |
JC Venter |
| Applications |
The predicted product size is (bp): 96. The observed product size(s) is(are) (bp): 95 (human). |
| Vector |
Construct size (kb): 5.150000095367432 DESCRIPTION OF VECTOR COMPONENT:
Name of vector: pBluescript SK-
Intact vector size: 2.960
Type of vector: phagemid
Vector end: EcoRI
Vector end: EcoRI
Cloning sites: KpnI ApaI DraII XhoI (SalI HincII AccI) ClaI HindIII EcoRV
EcoRI PstI SmaI BamHI SpeI XbaI EagI NotI SacII BstXI SacI
Polylinker sites: SacI BstXI SacII NotI EagI XbaI SpeI BamHI SmaI PstI EcoRI
EcoRV HindIII (ClaI Bsp106I) (HincII AccI SalI) XhoI
(Eco0109I DraII ApaI) KpnI
Construction: pUC19
Host range: Escherichia coli
Features (with orientation and position when available):
replicon: f1, ->
insert detection: lacZ', <-
primer site: M13-20, ->
promoter: T7, ->
MCS: KpnI...SacI, ->
promoter: T3, <-
promoter: lac, <-
primer site: M13 reverse, <-
replicon: pMB1
marker(s): ampR, <-
Cross references: |
| Insert |
DNA: cDNA DESCRIPTION OF INSERT COMPONENT:
Genome: Homo sapiens
Gene symbol: D4S815E
Genomic copy number: unique
Gene name: DNA Segment, single copy, expressed
Contains complete coding sequence?: U
Sequence homology: Homo sapiens protein phosphatase 2A, regulatory polypeptide
beta (55 kDa)
Chromosome: 4; Localization: 4 16.3 distal
Tissue: hippocampus, female, 2 years, oligo-dT and random primed
(Stratagene 936205), subtracted
Type of DNA: cDNA
Insert end: Modification: EcoRI linkers
Insert end: Modification: EcoRI linkers
Insert size (kb): 2.15
Cross references: DNA Seq. Acc.: M78063; EST: EST01650; Primer: M13 Forward Insert lengths(kb): 2.150000095367432 Tissue: hippocampus, female, 2 years, oligo-dT and random primed (Stratagene 936205), subtracted Gene product: protein phosphatase 2A, regulatory polypeptide beta (55 kDa) [D4S815E] |
| Insert Size (kb) |
2.150 |
| Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Shipping Information |
Distributed: DNA (dried). Rehydrate with TE. (amount: 200 ng) |
| Comments |
Restriction digests of the clone give the following sizes (kb): EcoRI--3.0, 1.9, 0.25; PstI--3.4, 1.1, 0.66; BamHI--5.2. EST01650 can be detected in genomic DNA using the following oligonucleotides (5'-3'): GACGTGTACAGCACTTTCCA and TGGGAGCCACTTGATCTT. EST01650 matches GenBank accession HUMPROP2AB with 76.81% identity over the sequence range: 1-289. This sequence record is for human protein phosphatase 2A, regulatory polypeptide beta (55 kDa). The predicted product size is (bp): 96. The observed product size(s) is(are) (bp): 95 (human). |
| References |
Korenberg JR, et al. Toward a cDNA map of the human genome. Genomics 29: 364-370, 1995. PubMed: 8666383
Adams MD, et al. Sequence identification of 2,375 human brain genes. Nature 355: 632-634, 1992. PubMed: 1538749
Durkin AS, et al. Chromosomal assignment of human brain expressed sequence tags (ESTS) by analzying fluorescently-labeled PCR products from hybrid cell panels. Cytogenet. Cell Genet. 65: 86-91, 1994. PubMed: 8404072
Maglott DR, et al259 human brain expressed sequence tags (ESTs): chromosome localization, subregional assignment, and sequence analysisIn: Maglott DR, et alIdentification of transcribed sequencesNew YorkPlenum Presspp. 273-288, 1994
J C Venter, personal communication
|
