Restriction digests of the clone give the following sizes (kb): EcoRI/BamHI--2.7, 0.7; HindIII--3.4; BglII--3.4; PstI--3.0, 0.4; EcoRI/HindIII--2.7, 0.7. The insert contains the following restriction sites (nt from the 5' end): BglII--178, 271; BalI--204; PstI--382. Detects a human genomic HindIII fragment of 4.6 kb. A full-length cDNA clone derived as a PCR product from monocyte cDNA. The oligonucleotides used were: 5' CTAACCCAGAAACATCCAATTCTC 3' and 5' GGTGTAATAGTTACAAAATATTCA 3'. Does not cross-hybridize to mouse DNA at 65C, 0.1 X SSC, 0.1% SDS. |
