| 產(chǎn)品名稱 | Cutaneotrichosporon oleaginosum (Zhou et al.) Liu et al. |
|---|---|
| 商品貨號 | B182017 |
| Deposited As | Candida curvata |
| Strain Designations | D |
| Application | Biodiesel production
Degrades beets Ref
  Bednarski W, et al. Utilization of beet molasses and whey for fat biosynthesis by a yeast. Agric. Wastes 18: 19-26, 1986. Degrades molasses Ref
Bednarski W, et al. Utilization of beet molasses and whey for fat biosynthesis by a yeast. Agric. Wastes 18: 19-26, 1986. Degrades prickly-pear juice Ref
Hassan M, et al. Production of single-cell oil from prickly-pear juice fermentation by Cryptococcus curvatus grown in batch culture. World J. Microbiol. Biotechnol. 10: 534-537, 1994. Degrades whey (Moon NJ, Hammond EG. Process for converting whey permeate to oil-containing yeast. US Patent 4,235,933 dated Nov 25 1980) Ref
Floetenmeyer MD, et al. Continuous culture fermentation of whey permeate to produce microbial oil. J. Dairy Sci. 68: 633-637, 1985. RefBednarski W, et al. Utilization of beet molasses and whey for fat biosynthesis by a yeast. Agric. Wastes 18: 19-26, 1986. Produces alpha-galactosidase Ref
West M, et al. Purification and properties of two lactose hydrolases from Trichosporon cutaneum. J. Gen. Microbiol. 136: 1483-1490, 1990. PubMed: 2124610Produces glucosidase, beta, acid, glucocerebrosidase
Produces lipids Ref
Brown BD, et al. A relationship between growth and lipid accumulation in Candida curvata D. J. Ferment. Bioeng. 68: 344-352, 1989. RefYkema A, et al. Growth yield, maintenance requirements, and lipid formation in the oleaginous yeast Apiotrichum curvatum. Biotechnol. Bioeng. 34: 1268-1276, 1989. RefYkema A, et al. Optimization of lipid production in the oleaginous yeast Apiotrichum curvatum in whey permeate. Appl. Microbiol. Biotechnol. 29: 211-218, 1988. RefVerwoert II, et al. Modification of the fatty-acid composition in lipids of the oleaginous yeast Apiotrichum curvatum by intraspecific spheroplast fusion. Appl. Microbiol. Biotechnol. 32: 327-333, 1989. (Moon NJ, Hammond EG. Process for converting whey permeate to oil-containing yeast. US Patent 4,235,933 dated Nov 25 1980) RefWang LW, et al. Spectrophotometric determination of polar and non-polar lipids in oleaginous yeast. World J. Microbiol. Biotechnol. 9: 350-352, 1993. RefHassan M, et al. Production of single-cell oil from prickly-pear juice fermentation by Cryptococcus curvatus grown in batch culture. World J. Microbiol. Biotechnol. 10: 534-537, 1994. RefFloetenmeyer MD, et al. Continuous culture fermentation of whey permeate to produce microbial oil. J. Dairy Sci. 68: 633-637, 1985. RefBednarski W, et al. Utilization of beet molasses and whey for fat biosynthesis by a yeast. Agric. Wastes 18: 19-26, 1986. Produces single-cell protein SCP Ref Hassan M, et al. Production of single-cell oil from prickly-pear juice fermentation by Cryptococcus curvatus grown in batch culture. World J. Microbiol. Biotechnol. 10: 534-537, 1994. |
| Biosafety Level | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format | frozen |
| Storage Conditions | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain | yes |
| Disclosure | This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC. |
| Preceptrol® | no |
| Genome Sequenced Strain | Yes |
| Comments | Influence of nitrogen- and iron-limitation on lipid production Ref
Hassan M, et al. Influence of nitrogen and iron limitations on lipid production by Cryptococcus curvatus grown in batch and fed-batch culture. Process Biochem. 31: 355-361, 1996. This strain was re-identified as Trichosporon oleaginosus based on the DNA barcode sequence comparison.
Peroxisomes Ref
Park WS, et al. Evidence of peroxisomes and peroxisomal enzyme activities in the oleaginous yeast Apiotrichum curvatum. Can. J. Microbiol. 37: 361-367, 1991. PubMed: 1878814Genome sequencing strain (Joint Genome Institute, Department of Energy, USA ) |
| Medium | ATCC® Medium 28: Emmons' modification of Sabouraud's agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 324: Malt extract agar |
| Growth Conditions | Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence (including the D1D2 region)
GTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATTGCTCTTTGAGCGTTAACTACATCCATCTACATCTGTGAACTGTTGATTGACTTCGGTCAATAACTTTTACAAACACTGTGTAATGAACGTCATGTTATTATAACAAAAATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTGAGTATCATGAAATCTCAACCATTAGGGTTTCTTAATGGCTTGGAATTGGGCGCTGCCACTTGCCTGGCTCGCCTTAAAAGAGTTAGCGTGTTAAACTTGTCGTAAACTGGCGTAATAAGTTTCGCTGGTGGTAGACTTGTGAAGGACGCTTCTAATCGTCTTCGGACACTTCTTGAACTCTGGTCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAAAGCTCAAATTTGTAATCTGGCTGTCTTCGATAGTCCGAGTTGTAATCTATAGACGTGTTTTCCGTGCTGGACCGTATCTAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGACAATCCCGTGCTTGATACGACCACCAGTGCTCTGTGATACACGTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTTCTTCAGATTCAGCTGGTTCTTCCAGTCTACTTCTGTGGAACGGGTCAACATCAGTTTTGTCCGGTGGATAAAGGTAGTAGGAATGTGACTCCCCCGGGAGTGTTATAGCCTATTATTGCATACACTGGGTGAGACTGAGGACTGCAGCTCGCCTTTTGGCCGGTCTTCGGACACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAAACGAC D1D2 region of the 28S ribosomal RNA gene CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAAAGCTCAAATTTGTAATCTGGCTGTCTTCGATAGTCCGAGTTGTAATCTATAGACGTGTTTTCCGTGCTGGACCGTATCTAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGACAATCCCGTGCTTGATACGACCACCAGTGCTCTGTGATACACGTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTTCTTCAGATTCAGCTGGTTCTTCCAGTCTACTTCTGTGGAACGGGTCAACATCAGTTTTGTCCGGTGGATAAAGGTAGTAGGAATGTGACTCCCCCGGGAGTGTTATAGCCTATTATTGCATACACTGGGTGAGACTGAGGACTGCAGCTCGCCTTTTGGCCGGTCTTCGGACACGTTCGAGCTTAGGATGTTGACATAATGGCTTTAAACGACCCGTC |
| Name of Depositor | Iowa State Univ. Res. Fndn. |
| U.S. Patent Number | |
| Chain of Custody | ATCC <-- Iowa State Univ. Res. Fndn. <-- NJ Moon |
| Isolation | Dairy plant |
| Cross References | Nucleotide (GenBank) : Y12080 A.curvatum mRNA for SIS1 protein. Nucleotide (GenBank) : Y10421 C.curvatus strain ATCC 20509 Ole1 gene. Nucleotide (GenBank) : Y12079 A.curvatum mRNA for heat shock protein 70. Nucleotide (GenBank) : HM802135 ITS including 5.8S rRNA gene and D1/D2 region of 26S rRNA gene Nucleotide (GenBank) : MATS00000000 Cutaneotrichosporon curvatus strain ATCC 20509, whole genome shotgun sequencing project |
| References | Yu X, et al. Oil production by oleaginous yeasts using the hydrolysate from pretreatment of wheat straw with dilute sulfuric acid. Bioresour. Technol. 102: 6134-6140, 2011. PubMed: 21463940 Gujjari P, et al. Characterization of oleaginous yeasts revealed two novel species: Trichosporon cacaoliposimilis sp. nov. and Trichosporon oleaginosus sp. nov. Mycologia. 103:1110-1118, 2011. PubMed: 21558504 Hassan M, et al. Influence of nitrogen and iron limitations on lipid production by Cryptococcus curvatus grown in batch and fed-batch culture. Process Biochem. 31: 355-361, 1996. Bednarski W, et al. Utilization of beet molasses and whey for fat biosynthesis by a yeast. Agric. Wastes 18: 19-26, 1986. Brown BD, et al. A relationship between growth and lipid accumulation in Candida curvata D. J. Ferment. Bioeng. 68: 344-352, 1989. Floetenmeyer MD, et al. Continuous culture fermentation of whey permeate to produce microbial oil. J. Dairy Sci. 68: 633-637, 1985. Hassan M, et al. Production of single-cell oil from prickly-pear juice fermentation by Cryptococcus curvatus grown in batch culture. World J. Microbiol. Biotechnol. 10: 534-537, 1994. Moon NJ, Hammond EG. Process for converting whey permeate to oil-containing yeast. US Patent 4,235,933 dated Nov 25 1980 Verwoert II, et al. Modification of the fatty-acid composition in lipids of the oleaginous yeast Apiotrichum curvatum by intraspecific spheroplast fusion. Appl. Microbiol. Biotechnol. 32: 327-333, 1989. Wang LW, et al. Spectrophotometric determination of polar and non-polar lipids in oleaginous yeast. World J. Microbiol. Biotechnol. 9: 350-352, 1993. Park WS, et al. Evidence of peroxisomes and peroxisomal enzyme activities in the oleaginous yeast Apiotrichum curvatum. Can. J. Microbiol. 37: 361-367, 1991. PubMed: 1878814 West M, et al. Purification and properties of two lactose hydrolases from Trichosporon cutaneum. J. Gen. Microbiol. 136: 1483-1490, 1990. PubMed: 2124610 Ykema A, et al. Growth yield, maintenance requirements, and lipid formation in the oleaginous yeast Apiotrichum curvatum. Biotechnol. Bioeng. 34: 1268-1276, 1989. Ykema A, et al. Optimization of lipid production in the oleaginous yeast Apiotrichum curvatum in whey permeate. Appl. Microbiol. Biotechnol. 29: 211-218, 1988. Close D, Ojumu J. Draft Genome Sequence of the Oleaginous Yeast Cryptococcus curvatus ATCC 20509. Genome Announc 4(6). pii: e01235-16, 2016. PubMed: 27811111 Liu XZ, et al. Towards an integrated phylogenetic classification of the Tremellomycetes. Stud. Mycol. 81: 85-147, 2015. PubMed: 26955199 |
| 梅經(jīng)理 | 17280875617 | 1438578920 |
| 胡經(jīng)理 | 13345964880 | 2438244627 |
| 周經(jīng)理 | 17757487661 | 1296385441 |
| 于經(jīng)理 | 18067160830 | 2088210172 |
| 沈經(jīng)理 | 19548299266 | 2662369050 |
| 李經(jīng)理 | 13626845108 | 972239479 |
