| 產品名稱 | Candida viswanathii Sandhu et Randhawa |
|---|---|
| 商品貨號 | B206796 |
| Deposited As | Candida tropicalis (Castellani) Berkhout |
| Strain Designations | PK 233 [NCYC 997, pK233] |
| Synonym | Trichosporon lodderae Phaff et al., Fermentotrichon lodderae (Phaff et al.) Novák et Zsolt, Candida lodderae (Phaff et al.) Meyer et Ahearn, Candida aquaetextoris Vallini et al. |
| Application | Degrades catalase
Degrades hydrocarbons
Produces alcohol oxidase
Produces carnitine acetyltransferase
Produces ergosterol
Produces ubiquinone-9
Produces urate oxidase uricase
Used in recycle type, continuous process for fermentation based on application of mixed culturing principle
Produces thiolase III in peroxisomes
Produces ergosterol and ubiquinone-9 in a single process
Produces extracellular mannon |
| Biosafety Level | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format | freeze-dried |
| Storage Conditions | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain | no |
| Disclosure | This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC. |
| Preceptrol® | no |
| Comments | Catalase activity
Fatty acid beta-oxidation
Characterization of peroxisomes |
| Morphology | On YM agar at 25°C after 10 days, colonies creamy white to dingy white, butryous, smooth, slightly raised, margin filamentous. Cells subglobose to ovoid, smooth, guttulate, 9-12 X 5-7.5μm. Pseudohyphae present. |
| Medium | ATCC® Medium 28: Emmons' modification of Sabouraud's agar ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD |
| Growth Conditions | Temperature: 20°C to 25°C
Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and
26S ribosomal RNA gene, partial sequence
GGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCACTGGACAGCTGCTTTGGCGGGGGGACTCGTTTCCGCCGCCAGAGGTCACAACTAAACCAAACTTTTTATTACCAGTCAACCATACGTTTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAGCCCGCGGGTTTGGTGTTGAGCAATACGCCAGGTTTGTTTGAAAGACGTACGTGGAGACTATATTAGCGACTTAGGTTCTACCAAAACGCTTGTGCAGTCGGCCCACCACAGCTTTTCTAACTTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 26S ribosomal RNA gene: ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCAGGTCCGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGCATTTTGCATGTTGCTTCTTCGGGGGCGGCCTCTGCGGTTTGTCGGGCCAGCATCAGTTTGGGCGG |
| Name of Depositor | Kyowa Ferm. Ind. Co., Ltd. |
| U.S. Patent Number | |
| Chain of Custody | ATCC <-- Kyowa Ferm. Ind. Co., Ltd. |
| Cross References | Nucleotide (GenBank) : X05604 Candida tropicalis mRNA for catalase. Nucleotide (GenBank) : M18832 C.tropicalis peroxisomal catalase mRNA, complete cds. Nucleotide (GenBank) : AB025647 nucleotide sequence of the promoter region of CT-T3A Nucleotide (GenBank) : AB025648 nucleotide sequence of the promoter region of CT-T3B Nucleotide (GenBank) : M18259 C.tropicalis POX2 gene encoding PXP-2 protein, complete cds. Nucleotide (GenBank) : M12161 Candida tropicalis acyl-coenzyme A oxidase I precursor, gene, Nucleotide (GenBank) : S77426 ICL=isocitrate lyase gene {promoter} [Candida tropicalis, pK233, Nucleotide (GenBank) : M24440 Candida tropicalis (ATCC 20336)small aleate-inducible peroxisomal Nucleotide (GenBank) : M12160 Yeast (C.tropicalis) POX4 gene encoding acyl-coenzyme A oxidase II Nucleotide (GenBank) : KU729067 ITS including 5.8S rRNA gene Nucleotide (GenBank) : KU729150 D1/D2 region of 28S rRNA gene |
| References | Eirich LD, et al. Cloning and characterization of three fatty alcohol oxidase genes from Candida tropicalis strain ATCC 20336. Appl Environ Microbiol 70: 4872-4879, 2004. PubMed: 15294826 Torkko JM, et al. Candida tropicalis expresses two mitochondrial 2-enoyl thioester reductases that are able to form both homodimers and heterodimers. J Biol Chem 278: 41213-41220, 2003. PubMed: 12890667 Kamauchi S, et al. Structurally and functionally conserved domains in the diverse hydrophilic carboxy-terminal halves of various yeast and fungal Na+/H+ antiporters (Nha1p). J. Biochem. 131: 821-831, 2002. PubMed: 12038978 Kato M, et al. Phylogenetic relationship and mode of evolution of yeast DNA topoisomerase II gene in the pathogenic Candida species. Gene 272: 275-281, 2001. PubMed: 11470534 Kanai T, et al. An n-alkane-responsive promoter element found in the gene encoding the peroxisomal protein of Candida tropicalis does not contain a C(6) zinc cluster DNA-binding motif. J Bacteriol 182: 2492-2497, 2000. PubMed: 10762250 Kanayama N, et al. Comparison of molecular structures and regulation of biosynthesis of unique thiolase isozymes localized only in peroxisomes of n-alkane-utilizable yeast, Candida tropicalis.. J Ferment Bioeng 78: 273-278, 1994. Kemp GC, et al. Activity and substrate specificity of the fatty alcohol oxidase of Candida tropicalis in organic solvents. Appl Microbiol Biotechnol 34: 441-445, 1991. Okamoto H, et al. Degradation of peroxisomal catalase in an N alkane-utilizable yeast Candida tropicalis. J Ferment Bioeng 72: 254-257, 1991. Kemp GD, et al. Light sensitivity of the n-alkane-induced fatty alcohol oxidase from Candida tropicalis and Yarrowia lipolytica. Appl Microbiol Biotechnol 32: 461-464, 1990. Tanak A, et al. Production of uricase by Candida tropicalis using n-alkane as a substrate. Appl Environ Microbiol 34: 342-346, 1977. PubMed: 200173 Kemp GD, et al. Inducible long chain alcohol oxidase from alkane-grown Candida tropicalis. Appl Microbiol Biotechnol 29: 370-374, 1988. Tarasova NV, et al. Method for preparing ergosterol and ubiquinone-9 in a single process. US Patent 3,965,130 dated Jun 22 1976 Miura Y. Recycle type, continuous process for fermentation based on application of mixed culturing principle. US Patent 3,767,534 dated Oct 23 1974 Ueda M, et al. Characterization of peroxisomes in an N alkane-utilizable yeast Candida tropicalis grown on glucose and propionate. J Ferment Bioeng 68: 411-416, 1989. Ueda M, et al. Peroxisomal localization of enzymes related to fatty acid beta-oxidation in an n-alkane-grown yeast, Candida tropicalis. Agric Biol Chem 49: 1821-1828, 1985. Ueda M, et al. Peroxisomal and mitochondrial carnitine acetyltransferases in alkane-grown yeast Candida tropicalis. Eur J Biochem 124: 205-210, 1982. PubMed: 7084226 Teranishi Y, et al. Induction of catalase activity by hydrocarbons in Candida tropicalis pK 233. Agric Biol Chem 38: 1221-1225, 1974. Teranishi Y, et al. Catalase activities of hydrocarbon-utilizing Candida yeasts. Agric Biol Chem 38: 1213-1220, 1974. Uejima Y, et al. Production of extracellular mannan by Candida tropicalis Pk 233. Trans Mycol Soc Jpn 27: 481-486, 1986. Torkko JM, et al. Candida tropicalis Etr1p and Saccharomyces cerevisiae Ybr026p (Mrf1'p), 2-enoyl thioester reductases essential for mitochondrial respiratory competence. Mol. Cell Biol. 21: 6243-6253, 2001. PubMed: 11509667 |
| 梅經理 | 17280875617 | 1438578920 |
| 胡經理 | 13345964880 | 2438244627 |
| 周經理 | 17757487661 | 1296385441 |
| 于經理 | 18067160830 | 2088210172 |
| 沈經理 | 19548299266 | 2662369050 |
| 李經理 | 13626845108 | 972239479 |
