| 產(chǎn)品名稱 |
HFBCK22 |
| 商品貨號 |
B220219 |
| Designations |
HFBCK22 |
| GenBank Number |
M85571
|
| Species |
Homo sapiens, human |
| Applications |
The predicted product size is (bp): 149. The observed product size(s) is(are) (bp): 156 (human). |
| Vector |
Construct size (kb): 4.0 DESCRIPTION OF VECTOR COMPONENT:
Name of vector: pBluescript SK-
Intact vector size: 2.960
Type of vector: phagemid
Vector end: EcoRI
Vector end: EcoRI
Cloning sites: KpnI ApaI DraII XhoI (SalI HincII AccI) ClaI HindIII EcoRV
EcoRI PstI SmaI BamHI SpeI XbaI EagI NotI SacII BstXI SacI
Polylinker sites: SacI BstXI SacII NotI EagI XbaI SpeI BamHI SmaI PstI EcoRI
EcoRV HindIII (ClaI Bsp106I) (HincII AccI SalI) XhoI
(Eco0109I DraII ApaI) KpnI
Construction: pUC19
Host range: Escherichia coli
Features (with orientation and position when available):
replicon: f1, ->
insert detection: lacZ', <-
primer site: M13-20, ->
promoter: T7, ->
MCS: KpnI...SacI, ->
promoter: T3, <-
promoter: lac, <-
primer site: M13 reverse, <-
replicon: pMB1
marker(s): ampR, <-
Cross references: |
| Insert |
DNA: cDNA DESCRIPTION OF INSERT COMPONENT:
Genome: Homo sapiens
Gene symbol: PRKCI
Gene name: protein kinase C, iota
Contains complete coding sequence?: N
Chromosome: X; Localization: X q21.3
Genome: Homo sapiens
Gene symbol: DXS1179E
Genomic copy number: unique
Gene name: DNA Segment, single copy, expressed
Contains complete coding sequence?: N
Chromosome: X; Localization: X
Tissue: fetal brain, female, 17-18 wk (Stratagene 936206)
Type of DNA: cDNA
Insert end: Modification: EcoRI linkers
Insert end: Modification: EcoRI linkers
Insert size (kb): 1.1
Cross references: DNA Seq. Acc.: L33881; EST: EST02087
Nucleotides 1-397 of the insert correspond to
nucleotides 1293-897 of L33881 with 98% identity.
DNA Seq. Acc.: M85571; EST: EST02087; Primer: M13 Forward;
THC id: THC82066 Insert lengths(kb): 1.100000023841858 Tissue: fetal brain, female, 17-18 wk (Stratagene 936206) Gene product: protein kinase C, iota [PRKCI] |
| Insert Size (kb) |
1.100 |
| Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Shipping Information |
Distributed: DNA (dried). Rehydrate with TE. (amount: 200 ng) |
| Comments |
Restriction digests of the clone give the following sizes (kb): EcoRI--2.9, 1.1; BamHI--4.0; HindIII--3.3, 0.4, 0.35; PstI--2.9, 1.1; PvuII--2.45, 1.55. EST02087 can be detected in genomic DNA using the following oligonucleotides (5'-3'): TGCTTCTCTGTCTGTACCCA and GATTTGCTCCGGGTAATAGG. Based on the size of the insert and the alignment with GenBank L33881 (2261 nt, CDS 205-1968), the clone appears to contain part of the coding region and some of the 3' untranslated region. The predicted product size is (bp): 149. The observed product size(s) is(are) (bp): 156 (human). |
| References |
Adams MD, et al. Sequence identification of 2,375 human brain genes. Nature 355: 632-634, 1992. PubMed: 1538749
Maglott DR, et al259 human brain expressed sequence tags (ESTs): chromosome localization, subregional assignment, and sequence analysisIn: Maglott DR, et alIdentification of transcribed sequencesNew YorkPlenum Presspp. 273-288, 1994
|
