Restriction digests of the clone give the following sizes (kb): KpnI--6.3, 1.5, 0.6; SstI--8.4; BamHI--4.6, 3.8. Linearized vector is transformed into the YAC-containing yeast cells, followed by plating on medium lacking lysine and uracil (and containing 10 mg/L adenine to enhance the red color phenotype of recombinant clones). Positive colonies should have the rescue plasmid integrated into the YAC clone near the ScaI site in the beta-lactamase (ampR) gene. Correctly integrated products will yield a 870 bp amplification product, that should be cleaved by PstI into two fragments: 705 bp and 165 bp. YAC end fragment clones can be isolated from properly integrated DNA by digestion with one of the enzymes in the polylinker, religation by circularization, and transformation into Escherichia coli. The order of the major features in a rcombinant YAC end fragment clone would be: T7 promoter - BamHI/polylinker/SacI - CEN end YAC insert - EcoRI - CEN - ARS - (TRP) - ScaI/ampR - pMB1 ori. TRP from pYAC4 is not really functional. Vector designed to rescue the CEN end of an insert from a yeast artificial chromosome (YAC) constructed in a pYAC4-derived vector. Based on homologous recombination with the pYAC vector. DNA from positive colonies can be screened for proper integration of the vector using the following primers: 5'- GCGCTTAATGCGCCGCTACAGGGCG -3' and 5'- GCTCACCGGCTCCAGATTTATCAGC -3', complementary to the f1 ori and ampR sequences respectively. The order of the major features of the rescue vector is: T7 promoter - SacI/polylinker/BamHI - LYS2 - XbaI - SphI - ScaI/ampR - pMB1 ori. |
